Java lcs problemtrabajos

Filtro

Mis búsquedas recientes
Filtrar por:
Presupuesto
a
a
a
Tipo
Habilidades
Idiomas
    Estado del trabajo
    78 java lcs problem trabajados encontrados, precios en USD
    Logo Design Finalizado left

    ...art associated with it. I have some base concepts to start from as examples for both options. With the vessel option, we would like an outline of the LCS vessel, something that represents it the LCS vessel doesn't have to have a lot of detail, over a wave feature. The 2nd option would be similar to Fibertech logo, which has the emphasis of the name

    $308 (Avg Bid)
    $308 Oferta Promedio
    92 ofertas
    build a facebook page Finalizado left

    ...which will run 6 days a week on a monthly basis in my local newspaper. The LCS Compute logo needs created, I am currently just pasting in a rough copy. If you are experienced in logos, we can discuss that as well. I have a local company to do the ad if needed. I need the LCS inside the computer with Compute either beside or below. Overall look needs

    $93 (Avg Bid)
    $93 Oferta Promedio
    14 ofertas

    ...resume along with your voice samples at SUGANDHA@LCS-WORLD.COM. Also please send your best rates for recording audios as follows: 5 Minute of finished audio: 15 minutes of finished audio: 30 minutes of finished audio: 45 minutes of finished audio: 1 hour of finished audio: Thanks, Sugandha Mathur SUGANDHA@[iniciar sesión para ver URL] [iniciar sesión para ver URL]

    $242 (Avg Bid)
    $242 Oferta Promedio
    1 ofertas

    We're looking to create a virtual stage to position and do camera work in Unreal Engine. Stage inspiration should the Riot NA LCS stage, Riot EU LCS stage, DreamHack Masters stage, and similar. We're interested in static brand elements, dynamic/controllable lighting and light objects, and buildout of player seating locations. We do not need the following

    $2518 (Avg Bid)
    $2518 Oferta Promedio
    30 ofertas

    ... Every single day we add the LCS ( a mixture of Octatonic and Isooctane 1:1 ml diluted in 50 ml of S-316) 1.25 ml into 50 ml of S-316 as our QC sample. Because every single bottle of S-316 cost more than 700$, we are wasting 50 ml of S-316 Without the ability to re-generate or separate it from the mixture of LCS. Scientific Report 15-20 pages

    $212 (Avg Bid)
    $212 Oferta Promedio
    11 ofertas

    ...in der EU, USA/Canada und Australien/Asia Pacific geschult werden. Rollenbeschreibung: - Trainer und Rolloutmanager für - Microsoft Dynamics 365 - Taskrecorder - LCS ...

    $29 / hr (Avg Bid)
    $29 / hr Oferta Promedio
    2 ofertas

    ...Experience Range - 3-10 Years Job Location - Bangalore Role - SW Dev Experience in working with Microsoft Dynamics 365 Operations/AX7 platform, Azure and Life Cycle Services (LCS) in highly advantageous. Experience in SSRS reporting, DIXF (Data Import Export Framework) tool and workflows of AX will also be considered an asset. Deep Understanding of

    $138 (Avg Bid)
    $138 Oferta Promedio
    6 ofertas
    Trophy icon Design a Logo -- 2 Finalizado left

    Design a brand logo for a new solar company.. Needing a logo for a solar company. Primary colors of blue ,red, yello...) something that has to do with solar panels or the sun or in that line Company name : La Compania Solar : You can incorporate the initials "LCS" into the design as [iniciar sesión para ver URL] inlcude on without the LCS needs to be in l...

    $54 (Avg Bid)
    Destacado Garantizado
    $54
    885 participaciones

    ...channel that has about 200k subscribers with a decent amount of average views per video. 70k+ sometimes regularly hitting 200k+ views. The entertainer of the channel is an ex-pro lcs player with quite a few close connections to alot of other popular entertainers. This is a gaming channel revolving around the game League of Legends. To tell you about the

    $2145 (Avg Bid)
    $2145 Oferta Promedio
    19 ofertas
    Make a Video Finalizado left

    ...channel that has about 200k subscribers with a decent amount of average views per video. 70k+ sometimes regularly hitting 200k+ views. The entertainer of the channel is an ex-pro lcs player with quite a few close connections to alot of other popular entertainers. This is a gaming channel revolving around the game League of Legends. To tell you about the

    $914 (Avg Bid)
    $914 Oferta Promedio
    2 ofertas

    We deliver with time and precision as set forth in the agreement. Our terms and Conditions are reasonable and we work directly with issui...Contact for genuine inquiries and i can provide you with the needed information. Name : Joan Maria Email : joanmariavan@[iniciar sesión para ver URL] Skype : mariajoanfinprov BGs | SBLCs | LCs | DLCs | PBs | BANK DRAFT ET AL

    $53244 (Avg Bid)
    $53244 Oferta Promedio
    3 ofertas

    I need a logo for my business the business is called I would like it laid out like this LCS Wills and Estate Consultants LTD I would like colours used Gold Silver and Black its a professional financial business

    $31 (Avg Bid)
    $31 Oferta Promedio
    106 ofertas
    Trophy icon Design a Logo for LCS Finalizado left

    Need improvements on the logo attached. The lettering (LCS) needs to be similar to the current logo, colors should be similar blue and platinum, letter could have some white or black. The design around the lettering should look like buildings coming at you like a 3D effect, this is for a commercial construction company. Please read the requirements

    $20 (Avg Bid)
    Concurso Principal
    $20
    34 participaciones
    Hire a Logo Designer Finalizado left

    I need a logo designed for my freelancing business. It's a services business as well as a portfolio and blog on a website. The name is LCS Freelancing Services. Something simple but effective not fussy on colours but thinking a black and white scheme.

    $26 (Avg Bid)
    $26 Oferta Promedio
    76 ofertas

    Dear Freelancer, We have received a new project in which the audios in German needs to be transcribed to German. There are multiple files in this project with the ...duration of files is 75 minutes in total the content of the audio is generic and related to a Museum tour guide. Kindly make bids for this project. Regards, Akash Chaudhary LCS

    $126 (Avg Bid)
    $126 Oferta Promedio
    25 ofertas
    Get Data Entry Done Finalizado left

    I need you to scrape data from the league of legends website to fill a spreadsheet. You will be going to the match pages for match pages for games in the 2017 NA LCS season (about 90 matches with 2-3 games per match) and inputing player data into a spreadsheet.

    $123 (Avg Bid)
    $123 Oferta Promedio
    30 ofertas

    Por favor, regístrate o inicia sesión para ver los detalles.

    Destacado Sellado Concurso Principal Acuerdo de Confidencialidad

    Im a pro League of Legends player, currently working in EU LCS, i need a really good artist, that can draw me and my favorite champion, leaning back to back :)

    $146 (Avg Bid)
    $146 Oferta Promedio
    14 ofertas

    For the LCS project I sent you.

    $100 (Avg Bid)
    $100 Oferta Promedio
    1 ofertas

    We need a representative that will negotiate facilities for our firm,s clients at a single digits interest rate. the facility repayment will be guaranteed by ...that will negotiate facilities for our firm,s clients at a single digits interest rate. the facility repayment will be guaranteed by Nigerian Banks with SBLC or other forms of LCs and Full BG.

    $2500 (Avg Bid)
    $2500 Oferta Promedio
    1 ofertas

    I am...website that gives a live feed of league of legends (LCS) in text format. The website is to be released in the up coming weeks and I need a poster picture that I can post on social media. Could anyone make me a poster for very cheap. And also would be nice if you knew about league of legends and the LCS. Contact me if you match this criteria.

    $70 (Avg Bid)
    $70 Oferta Promedio
    13 ofertas
    LCS Java Program Finalizado left

    ...longest common subsequence problem. Be sure to include your own test cases. S1 = ACCGGTCGACTGCGCGGAAGCCGGCCGAA S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA S3 = ATTGCATTGCATGGGCGCGATGCATTTGGTTAATTCCTCG S4 = CTTGCTTAAATGTGCA Compare each of the provided strings to each other and your test cases. Compare by pairs only, finding the LCS of the pair. Program

    $27 (Avg Bid)
    $27 Oferta Promedio
    9 ofertas
    Build Website Finalizado left

    1. Kindly refer [iniciar sesión para ver URL] 2. Also refer [iniciar sesión para ver URL] (Both are prepared by the same firm) for this company LCS India 3. New website is to be prepared 4. Domain & Hosting will be taken care of 5. Only designing & development of the website to be done 6. Also refer the website ([iniciar sesión para ver URL])

    $133 (Avg Bid)
    $133 Oferta Promedio
    19 ofertas
    Translate Something Finalizado left

    ...Language Consultancy Services Pvt. Ltd. (LCS) is ISO 9001:2008 certified for quality management systems. Established in 2005 and incorporated as Private Limited Company in 2008, LCS is a leading global language solutions provider, enabling companies to enter global markets with high quality multilingual products. LCS strives to deliver reliable and quality

    $252 (Avg Bid)
    $252 Oferta Promedio
    2 ofertas
    Training on MSC ADAMS Finalizado left

    ...Joint Initial Conditions (ICs) Merging Geometry Angle Measures One DOF Pendulum Euler Angles (Rotation Sequence) Precise Positioning: Rotate Modeling Friction Measures in LCS Inclined Plane Building Geometry Construction Geometry Properties Solid Geometry Precise Positioning: Move Lift Mechanism I Applying Motion Joint Motion Functions in

    $700 (Avg Bid)
    $700 Oferta Promedio
    1 ofertas
    Design a Logo(s) Finalizado left

    Black Hat Gaming ...Make it unique and make it ours!! :) Here are a few examples of icons that are in our field. We want to out-do all of these if possible. [iniciar sesión para ver URL]

    $30 (Avg Bid)
    $30 Oferta Promedio
    16 ofertas

    Image matching based on contour comparison.

    $155 (Avg Bid)
    $155 Oferta Promedio
    7 ofertas
    Projetar um Logo Finalizado left

    Gostaria de um Logo pra LCS CHANNEL , perfil FACEBOOK. gostaria de inovação , brilho . e qualidade.

    $1876 (Avg Bid)
    $1876 Oferta Promedio
    6 ofertas

    ...him the security, to be sure, that the wheel and tyre fit on his car (based on German TUEV Certificates).rnrnCheck the demo: rn[iniciar sesión para ver URL]rnrnThe solution is based on PHP5, MYsql5, JavaScript, HTML, XML and does work with a template, which allows the customers to customize the look and layout to match

    $309 - $927
    Urgente Sellado
    $309 - $927
    25 ofertas
    Icon/Emblem Finalizado left

    I want a simple website icon/emblem. It would be displayed on the tab of our website as our icon. If we get popular enough we will put it on a few t -...with both words/letters/icon, or two icons one with just the picture and one with words under it. Examples: [iniciar sesión para ver URL]

    $27 (Avg Bid)
    $27 Oferta Promedio
    2 ofertas
    Find an Accountant Finalizado left

    ...We offer bank instruments on lease but not direct funding. These bank instruments can be in the form of Bank Guarantee (BG) or Standby Letter of Credit (SBLC) as well as PBs, LCs, DLC et al. Our bank instruments can be monetized with a Lender or Funding or can be used as a Collateral for Loans as well as for all kinds of Trade, Commodity trading and others

    $250 - $750
    $250 - $750
    0 ofertas

    ...cash requirements and secure availability of fund to finance BUs needs. Handling Daily/weekly bank reporting & managing facility utilization (i.e. follow up the position of LCs IBCs DCs Daily checks on our bank position and related reports ) Cash flow variance analysis & preparation of the trend analysis for discussion with management Follow

    $22 / hr (Avg Bid)
    $22 / hr Oferta Promedio
    11 ofertas

    ...cash requirements and secure availability of fund to finance BUs needs. Handling Daily/weekly bank reporting & managing facility utilization (i.e. follow up the position of LCs IBCs DCs Daily checks on our bank position and related reports ) Cash flow variance analysis & preparation of the trend analysis for discussion with management Follow

    $20 / hr (Avg Bid)
    $20 / hr Oferta Promedio
    6 ofertas
    Trophy icon Design a Website Mockup for Gamer's End Finalizado left

    ...[iniciar sesión para ver URL] Gamer's End gaming centre not only deals with computer gaming but also trading card games such as Magic the Gathering and eSports such as League of Legends LCS etc. The website design needs to be appealing to game players from ages 12 to 39. Attached is the company Logo that you can incorporate into the website design. You can also

    $64 (Avg Bid)
    Garantizado
    $64
    15 participaciones
    Build a Website Finalizado left

    I want to build a League of Legends LCS betting site, It works just like [iniciar sesión para ver URL], it could be reference. Their site should be based on WordPress 1. I can add betting events, set up odds. 2. The betting currency is bitcoin, wallet will be located on the server, you can use its RPC API([iniciar sesión para ver URL](JSON-RPC))

    $1314 (Avg Bid)
    $1314 Oferta Promedio
    21 ofertas

    Design a logo for my super-awesome comic book store, "Legendary Comics & Stuff" ("LCS"). As much as possible, make it look like an awesome shield, but stay away from making it look too much like famous logos or graphics belonging to DC, Marvel, etc.

    $66 (Avg Bid)
    $66 Oferta Promedio
    29 ofertas
    Gamer WebDesign Finalizado left

    I need a website for a championship game. Initially there will be 13 screens. Already have a wireframe. Screens: -Home -Category -SubC...-Teams / Players -Forum -Bracket -Photos / Videos -3x CRUDs with 3 or 4 steps (user, team and another i will show future) Example I like: [iniciar sesión para ver URL]

    $656 (Avg Bid)
    $656 Oferta Promedio
    14 ofertas
    Design me a Product Finalizado left

    ...each light point. Light controllers are communicating with the Segment Controller (SC) using LonWorks protocol on powerline media (see Echelon PL31xx smart transceivers) . LCs receive commands (ON, OFF, dimming, setvalues and parameters) and send data (e.g. lamp and ballast failures, low power factor, voltage, current, power, energy, burning hours

    $13199 (Avg Bid)
    Destacado
    $13199 Oferta Promedio
    20 ofertas

    i need urgent logo , website design in psd and its html . its a simple task i can do my self but i am busy...but i am busy in many websites of my clients so i need some ont who can do for me , this html is need to be clean ,this files are use in wordpress website. company name is "LCS groups" life care groups its an life insurance and medical company.

    $71 (Avg Bid)
    Urgente
    $71 Oferta Promedio
    13 ofertas

    I need someone to write the content for this website [iniciar sesión para ver URL] Please check all the pages there are sections on each page. i will provide a simple description of each section and you will have to write a full description. In total it should be about 4000-5000 words in total

    $116 (Avg Bid)
    $116 Oferta Promedio
    52 ofertas

    I need a LCS 2005 / OCS 2007 R2 guru to fix an issue with our recent migration from LCS 2005 to OCS 2007 R2. I have 1 Standard Edition FE, 1 Director, 1 Edge. Everything internally works fine. We see “status unknown” for external contacts and cannot IM external or PIC contacts. We have 99.9% of users still on LCS 2005 servers, but have an OCS

    $200 (Avg Bid)
    $200 Oferta Promedio
    1 ofertas

    ...You may remember a few months back you did some work for a Freelancer employer; WebChefs. WebChefs is no longer around as a company. It has been absorbed into the company "LCS Group", hence why we are contacting you today. The work you did was a website design template for Jerry Green Dog Rescue. You mentioned during that project that you would

    $151 (Avg Bid)
    $151 Oferta Promedio
    7 ofertas

    The outcome of this project is a new email template that we can use to broadcast a message to our email list of prospective clients. We are promoting a new telephone system that we have for sale. You will need to design the email and then convert it into HTML code we can insert into the Constant Contact system ([iniciar sesión para ver URL]). Your coding needs to be compliant...

    $0 (Avg Bid)
    $0 Oferta Promedio
    1 ofertas

    ...programmer to implement a specific algorithm using GPGPU technologies. The algorithm is known as "[longest common subsequence][1]" (LCS). Your implementation should meet the following requirements: * Programmed in C++ or Java (via jCUDA) * Should take only two arguments--the two strings that are being compared. You may assume only that the two strings

    $315 (Avg Bid)
    $315 Oferta Promedio
    2 ofertas

    I need a developer to build a LCS (Longest Common Subsequence) algorithm that is similar to as given below: I am wondering if someone has the time to create a C++, Java, or Perl (Providers Choice) program to implement the LCS Problem. This should find the longest common subsequence between 2 strings. The strings should be input by the user. This

    $24 (Avg Bid)
    $24 Oferta Promedio
    8 ofertas

    I need a hardware that does this job 1. Capture an image from seven segment LCD after triggered via socket request 2. Send this image to a p...will give text / string representation of this image after triggered via socket request I have attached result from LCD that we want to use, We will send a sample of this LCS to selected freelancer.

    $425 (Avg Bid)
    $425 Oferta Promedio
    6 ofertas

    ...must support audio, USB, serial ports, etc as you would expect. I am unable to get NOR boot to work on this board, so you may need JTAG experience. Experience with LVDS LCS panels is also preferred. You will be required to document all steps involved to build the image, deploy to the board etc., and be able to provide support via email for at

    $987 (Avg Bid)
    $987 Oferta Promedio
    4 ofertas
    LCS Clothing Website Finalizado left

    We are looking for someone to code a site that is an offshoot our current business: Most of the back end functionality has been done. We need a few add-ons to the backend. However the main part of this project is finishing the visual front end. The project will need a website administrator for a few months once it is complete. So please also indicate a nominal fee to be available should you be ...

    $660 (Avg Bid)
    $660 Oferta Promedio
    16 ofertas
    lcs project Finalizado left

    As discussed

    $500 (Avg Bid)
    $500 Oferta Promedio
    1 ofertas
    ASN.1 decoder Finalizado left

    ...DefaultSMS-Handling, Diagnostics, Ext-GeographicalInformation, IMSI, IMEI, IPAddress, ISDN-AddressString, LCSCause, LCSClientExternalID, LCSClientIdentity, LCSClientInternalID, LCSClientType, LCS-Priority, LCSQoSInfo, LevelOfCAMELService, LocalSequenceNumber, LocationAreaAndCell, LocationAreaCode, LocationType, ManagementExtensions, MessageReference, MSISDN, NotificationToMSUser

    $30 - $100
    $30 - $100
    0 ofertas